Review



human monocytic leukemia cell line  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    ATCC human monocytic leukemia cell line
    Human Monocytic Leukemia Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 20238 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monocytic+leukemia+cell+line+thp+1/THP-1/pmc13126472-368-12-25
    Average 99 stars, based on 20238 article reviews
    human monocytic leukemia cell line - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    CRISPR:

    Article Title: TET1 deficiency amplifies macrophage inflammatory signaling associated with Crohn's disease.
    Article Snippet: .. Generation of THP-1 TET1 and TET2 KO CRISPR Cell lines and differentiation into macrophages The human monocytic leukemia cell line THP-1 (ATCC TIB-202) was used to create CRISPR KO cell lines with guide RNAs specific for TET1 ( A A C C U G C A A U G G G U U U A C A A) or TET2 ( U U U U C A A C A C A U A A C U G C A G) and transfected to generate homozygous clones with the respective parental negative control (Synthego, California, USA). .. THP-1 WT, TET1 KO, and TET2 KO monocytes cells were cultured and maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum (Gibco).

    Article Title: TET1 deficiency amplifies macrophage inflammatory signaling associated with Crohn’s disease
    Article Snippet: .. The human monocytic leukemia cell line THP-1 (ATCC TIB-202) was used to create CRISPR KO cell lines with guide RNAs specific for TET1 (AACCUGCAAUGGGUUUACAA) or TET2 (UUUUCAACACAUAACUGCAG) and transfected to generate homozygous clones with the respective parental negative control (Synthego, California, USA). .. THP-1 WT, TET1 KO, and TET2 KO monocytes cells were cultured and maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum (Gibco).

    Transfection:

    Article Title: TET1 deficiency amplifies macrophage inflammatory signaling associated with Crohn's disease.
    Article Snippet: .. Generation of THP-1 TET1 and TET2 KO CRISPR Cell lines and differentiation into macrophages The human monocytic leukemia cell line THP-1 (ATCC TIB-202) was used to create CRISPR KO cell lines with guide RNAs specific for TET1 ( A A C C U G C A A U G G G U U U A C A A) or TET2 ( U U U U C A A C A C A U A A C U G C A G) and transfected to generate homozygous clones with the respective parental negative control (Synthego, California, USA). .. THP-1 WT, TET1 KO, and TET2 KO monocytes cells were cultured and maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum (Gibco).

    Article Title: TET1 deficiency amplifies macrophage inflammatory signaling associated with Crohn’s disease
    Article Snippet: .. The human monocytic leukemia cell line THP-1 (ATCC TIB-202) was used to create CRISPR KO cell lines with guide RNAs specific for TET1 (AACCUGCAAUGGGUUUACAA) or TET2 (UUUUCAACACAUAACUGCAG) and transfected to generate homozygous clones with the respective parental negative control (Synthego, California, USA). .. THP-1 WT, TET1 KO, and TET2 KO monocytes cells were cultured and maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum (Gibco).

    Clone Assay:

    Article Title: TET1 deficiency amplifies macrophage inflammatory signaling associated with Crohn's disease.
    Article Snippet: .. Generation of THP-1 TET1 and TET2 KO CRISPR Cell lines and differentiation into macrophages The human monocytic leukemia cell line THP-1 (ATCC TIB-202) was used to create CRISPR KO cell lines with guide RNAs specific for TET1 ( A A C C U G C A A U G G G U U U A C A A) or TET2 ( U U U U C A A C A C A U A A C U G C A G) and transfected to generate homozygous clones with the respective parental negative control (Synthego, California, USA). .. THP-1 WT, TET1 KO, and TET2 KO monocytes cells were cultured and maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum (Gibco).

    Article Title: TET1 deficiency amplifies macrophage inflammatory signaling associated with Crohn’s disease
    Article Snippet: .. The human monocytic leukemia cell line THP-1 (ATCC TIB-202) was used to create CRISPR KO cell lines with guide RNAs specific for TET1 (AACCUGCAAUGGGUUUACAA) or TET2 (UUUUCAACACAUAACUGCAG) and transfected to generate homozygous clones with the respective parental negative control (Synthego, California, USA). .. THP-1 WT, TET1 KO, and TET2 KO monocytes cells were cultured and maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum (Gibco).

    Negative Control:

    Article Title: TET1 deficiency amplifies macrophage inflammatory signaling associated with Crohn's disease.
    Article Snippet: .. Generation of THP-1 TET1 and TET2 KO CRISPR Cell lines and differentiation into macrophages The human monocytic leukemia cell line THP-1 (ATCC TIB-202) was used to create CRISPR KO cell lines with guide RNAs specific for TET1 ( A A C C U G C A A U G G G U U U A C A A) or TET2 ( U U U U C A A C A C A U A A C U G C A G) and transfected to generate homozygous clones with the respective parental negative control (Synthego, California, USA). .. THP-1 WT, TET1 KO, and TET2 KO monocytes cells were cultured and maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum (Gibco).

    Article Title: TET1 deficiency amplifies macrophage inflammatory signaling associated with Crohn’s disease
    Article Snippet: .. The human monocytic leukemia cell line THP-1 (ATCC TIB-202) was used to create CRISPR KO cell lines with guide RNAs specific for TET1 (AACCUGCAAUGGGUUUACAA) or TET2 (UUUUCAACACAUAACUGCAG) and transfected to generate homozygous clones with the respective parental negative control (Synthego, California, USA). .. THP-1 WT, TET1 KO, and TET2 KO monocytes cells were cultured and maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum (Gibco).

    other:

    Article Title: The long noncoding RNA lnc-FAM164A1 -ACLY axis promotes pro-inflammatory responses in human primary macrophages: a systems approach
    Article Snippet: Lipofectamine 3000 Reagent (L3000015) was from Life Technologies.



    Similar Products

    99
    ATCC human monocytic leukemia cell line
    Human Monocytic Leukemia Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monocytic+leukemia+cell+line+thp+1/THP-1/pmc13126472-368-12-25
    Average 99 stars, based on 1 article reviews
    human monocytic leukemia cell line - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    95
    CLS Cell Lines Service GmbH monocytic leukemia cell line thp 1
    Monocytic Leukemia Cell Line Thp 1, supplied by CLS Cell Lines Service GmbH, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monocytic+leukemia+cell+line+thp+1/THP-1+Cells/pm42172777-96-5-11
    Average 95 stars, based on 1 article reviews
    monocytic leukemia cell line thp 1 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    99
    ATCC monocytic leukemia cell line thp 1
    Monocytic Leukemia Cell Line Thp 1, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monocytic+leukemia+cell+line+thp+1/THP-1/pm42269602-371-2-11
    Average 99 stars, based on 1 article reviews
    monocytic leukemia cell line thp 1 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC human leukemia monocytic cell line thp 1
    Human Leukemia Monocytic Cell Line Thp 1, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monocytic+leukemia+cell+line+thp+1/THP-1/pm42259145-65-19-7
    Average 99 stars, based on 1 article reviews
    human leukemia monocytic cell line thp 1 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Korean Cell Line Bank monocytic leukemia cell line thp 1
    TAMpep-IP reduces phosphorylation of STAT6 in M2 macrophages. (A) Schematic structure of TAMpep-IP composed of an M2 macrophage-homing peptide (TAMpep), a cleavable linker, and a STAT6-inhibitory peptide (IP). <t>(B)</t> <t>THP-1</t> cells were differentiated into M0, M1, or M2 macrophages and stained for phosphorylated STAT6 (p-STAT6; red). Nuclear staining was performed with DAPI (blue). Immunofluorescence microscopy revealed elevated nuclear p-STAT6 in M2 macrophages compared to M0 and M1. Representative confocal images were acquired using a 40× objective lens. Scale bars, 20 μm. (C) M0 and M2 macrophages were treated with TAMpep, IP, or TAMpep-IP (0.5 μM, 72 h). Flow cytometry was used to measure p-STAT6 expression levels (mean fluorescence intensity), showing that TAMpep-IP significantly reduced p-STAT6 in M2 macrophages. (D) Western blot analysis was performed to detect p-STAT6 and total STAT6 levels in M2 macrophages after administration with TAMpep, IP, or TAMpep-IP (0.5 μM, 72 h). TAMpep-IP effectively reduced p-STAT6. The experiment was performed in triplicate. All data are presented as mean ± SEM. *p<0.05, **p<0.01, ***p < 0.001 and ****p < 0.0001..
    Monocytic Leukemia Cell Line Thp 1, supplied by Korean Cell Line Bank, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monocytic+leukemia+cell+line+thp+1/1+cells+thp/pmc13272300-34-2-7
    Average 86 stars, based on 1 article reviews
    monocytic leukemia cell line thp 1 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    ATCC human monocyte leukemia cell line
    TAMpep-IP reduces phosphorylation of STAT6 in M2 macrophages. (A) Schematic structure of TAMpep-IP composed of an M2 macrophage-homing peptide (TAMpep), a cleavable linker, and a STAT6-inhibitory peptide (IP). <t>(B)</t> <t>THP-1</t> cells were differentiated into M0, M1, or M2 macrophages and stained for phosphorylated STAT6 (p-STAT6; red). Nuclear staining was performed with DAPI (blue). Immunofluorescence microscopy revealed elevated nuclear p-STAT6 in M2 macrophages compared to M0 and M1. Representative confocal images were acquired using a 40× objective lens. Scale bars, 20 μm. (C) M0 and M2 macrophages were treated with TAMpep, IP, or TAMpep-IP (0.5 μM, 72 h). Flow cytometry was used to measure p-STAT6 expression levels (mean fluorescence intensity), showing that TAMpep-IP significantly reduced p-STAT6 in M2 macrophages. (D) Western blot analysis was performed to detect p-STAT6 and total STAT6 levels in M2 macrophages after administration with TAMpep, IP, or TAMpep-IP (0.5 μM, 72 h). TAMpep-IP effectively reduced p-STAT6. The experiment was performed in triplicate. All data are presented as mean ± SEM. *p<0.05, **p<0.01, ***p < 0.001 and ****p < 0.0001..
    Human Monocyte Leukemia Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monocytic+leukemia+cell+line+thp+1/THP-1/pm42215985-291-1-11
    Average 99 stars, based on 1 article reviews
    human monocyte leukemia cell line - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC acute monocytic leukemia cell line
    TAMpep-IP reduces phosphorylation of STAT6 in M2 macrophages. (A) Schematic structure of TAMpep-IP composed of an M2 macrophage-homing peptide (TAMpep), a cleavable linker, and a STAT6-inhibitory peptide (IP). <t>(B)</t> <t>THP-1</t> cells were differentiated into M0, M1, or M2 macrophages and stained for phosphorylated STAT6 (p-STAT6; red). Nuclear staining was performed with DAPI (blue). Immunofluorescence microscopy revealed elevated nuclear p-STAT6 in M2 macrophages compared to M0 and M1. Representative confocal images were acquired using a 40× objective lens. Scale bars, 20 μm. (C) M0 and M2 macrophages were treated with TAMpep, IP, or TAMpep-IP (0.5 μM, 72 h). Flow cytometry was used to measure p-STAT6 expression levels (mean fluorescence intensity), showing that TAMpep-IP significantly reduced p-STAT6 in M2 macrophages. (D) Western blot analysis was performed to detect p-STAT6 and total STAT6 levels in M2 macrophages after administration with TAMpep, IP, or TAMpep-IP (0.5 μM, 72 h). TAMpep-IP effectively reduced p-STAT6. The experiment was performed in triplicate. All data are presented as mean ± SEM. *p<0.05, **p<0.01, ***p < 0.001 and ****p < 0.0001..
    Acute Monocytic Leukemia Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monocytic+leukemia+cell+line+thp+1/THP-1/pm34698510-40-2-19
    Average 99 stars, based on 1 article reviews
    acute monocytic leukemia cell line - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC human monocytic leukemia cell line thp 1 cells
    TAMpep-IP reduces phosphorylation of STAT6 in M2 macrophages. (A) Schematic structure of TAMpep-IP composed of an M2 macrophage-homing peptide (TAMpep), a cleavable linker, and a STAT6-inhibitory peptide (IP). <t>(B)</t> <t>THP-1</t> cells were differentiated into M0, M1, or M2 macrophages and stained for phosphorylated STAT6 (p-STAT6; red). Nuclear staining was performed with DAPI (blue). Immunofluorescence microscopy revealed elevated nuclear p-STAT6 in M2 macrophages compared to M0 and M1. Representative confocal images were acquired using a 40× objective lens. Scale bars, 20 μm. (C) M0 and M2 macrophages were treated with TAMpep, IP, or TAMpep-IP (0.5 μM, 72 h). Flow cytometry was used to measure p-STAT6 expression levels (mean fluorescence intensity), showing that TAMpep-IP significantly reduced p-STAT6 in M2 macrophages. (D) Western blot analysis was performed to detect p-STAT6 and total STAT6 levels in M2 macrophages after administration with TAMpep, IP, or TAMpep-IP (0.5 μM, 72 h). TAMpep-IP effectively reduced p-STAT6. The experiment was performed in triplicate. All data are presented as mean ± SEM. *p<0.05, **p<0.01, ***p < 0.001 and ****p < 0.0001..
    Human Monocytic Leukemia Cell Line Thp 1 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monocytic+leukemia+cell+line+thp+1/THP-1/pm42201615-47-9-19
    Average 99 stars, based on 1 article reviews
    human monocytic leukemia cell line thp 1 cells - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC thp 1 human monocytic leukemia cell lines
    B. lactis V9 Induces Immune Activation In Vitro . (a) Experimental workflow for evaluating cytokine responses in <t>THP-1–derived</t> macrophages. (b) Levels of cytokines TNF-α, IL-6, and IL-10 at different dose gradients. LPS; positive control; Control: blank control. * P < 0.05; ** P < 0.01, *** P < 0.0001; Kruskal–Wallis test.
    Thp 1 Human Monocytic Leukemia Cell Lines, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monocytic+leukemia+cell+line+thp+1/THP-1/pmc13246658-44-19-29
    Average 99 stars, based on 1 article reviews
    thp 1 human monocytic leukemia cell lines - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    TAMpep-IP reduces phosphorylation of STAT6 in M2 macrophages. (A) Schematic structure of TAMpep-IP composed of an M2 macrophage-homing peptide (TAMpep), a cleavable linker, and a STAT6-inhibitory peptide (IP). (B) THP-1 cells were differentiated into M0, M1, or M2 macrophages and stained for phosphorylated STAT6 (p-STAT6; red). Nuclear staining was performed with DAPI (blue). Immunofluorescence microscopy revealed elevated nuclear p-STAT6 in M2 macrophages compared to M0 and M1. Representative confocal images were acquired using a 40× objective lens. Scale bars, 20 μm. (C) M0 and M2 macrophages were treated with TAMpep, IP, or TAMpep-IP (0.5 μM, 72 h). Flow cytometry was used to measure p-STAT6 expression levels (mean fluorescence intensity), showing that TAMpep-IP significantly reduced p-STAT6 in M2 macrophages. (D) Western blot analysis was performed to detect p-STAT6 and total STAT6 levels in M2 macrophages after administration with TAMpep, IP, or TAMpep-IP (0.5 μM, 72 h). TAMpep-IP effectively reduced p-STAT6. The experiment was performed in triplicate. All data are presented as mean ± SEM. *p<0.05, **p<0.01, ***p < 0.001 and ****p < 0.0001..

    Journal: Frontiers in Immunology

    Article Title: STAT6 inhibition of M2 macrophages suppresses tumor growth by modulating the tumor microenvironment in colon cancer model

    doi: 10.3389/fimmu.2026.1733991

    Figure Lengend Snippet: TAMpep-IP reduces phosphorylation of STAT6 in M2 macrophages. (A) Schematic structure of TAMpep-IP composed of an M2 macrophage-homing peptide (TAMpep), a cleavable linker, and a STAT6-inhibitory peptide (IP). (B) THP-1 cells were differentiated into M0, M1, or M2 macrophages and stained for phosphorylated STAT6 (p-STAT6; red). Nuclear staining was performed with DAPI (blue). Immunofluorescence microscopy revealed elevated nuclear p-STAT6 in M2 macrophages compared to M0 and M1. Representative confocal images were acquired using a 40× objective lens. Scale bars, 20 μm. (C) M0 and M2 macrophages were treated with TAMpep, IP, or TAMpep-IP (0.5 μM, 72 h). Flow cytometry was used to measure p-STAT6 expression levels (mean fluorescence intensity), showing that TAMpep-IP significantly reduced p-STAT6 in M2 macrophages. (D) Western blot analysis was performed to detect p-STAT6 and total STAT6 levels in M2 macrophages after administration with TAMpep, IP, or TAMpep-IP (0.5 μM, 72 h). TAMpep-IP effectively reduced p-STAT6. The experiment was performed in triplicate. All data are presented as mean ± SEM. *p<0.05, **p<0.01, ***p < 0.001 and ****p < 0.0001..

    Article Snippet: The human monocytic leukemia cell line THP-1 (KCLB; Korean Cell Line Bank, Seoul, Korea) was cultured in RPMI 1640 medium (Welgene, Gyeongsangbuk, Korea) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1% penicillin–streptomycin (Hyclone, Logan, UT, USA).

    Techniques: Phospho-proteomics, Staining, Immunofluorescence, Microscopy, Flow Cytometry, Expressing, Fluorescence, Western Blot

    TAMpep-IP inhibits polarization of M2 macrophages. (A) THP-1 monocytes were differentiated into M0 and M2 macrophages, and M2 cells were treated with TAMpep-IP (0.5 μM, 72 h). Quantitative RT-PCR analysis showed that TAMpep-IP significantly reduced the mRNA expression of TGF-β and Arg-1, two markers associated with M2 polarization. (B) ELISA was performed to measure the levels of secreted TGF-β and IL-13 in the culture supernatant of M0, M2, and TAMpep-IP–treated M2 macrophages (72 h). TAMpep-IP markedly decreased secretion of both cytokines. (C) Flow cytometric analysis was used to assess CD206 surface expression in M0, M2, and TAMpep-IP–treated M2 macrophages (72 h). CD206 expression was significantly decreased in the TAMpep-IP group compared to untreated M2 macrophages. All data are presented as mean ± SEM. *p<0.05, **p<0.01, ***p<0.001, ****p < 0.0001. (D) The expression of IL-1β mRNA was analyzed by quantitative RT-PCR in M0, M1, and M2 macrophages after TAMpep-IP. TAMpep-IP significantly upregulated IL-1β expression in M2 macrophages, to levels comparable with M1-polarized cells.

    Journal: Frontiers in Immunology

    Article Title: STAT6 inhibition of M2 macrophages suppresses tumor growth by modulating the tumor microenvironment in colon cancer model

    doi: 10.3389/fimmu.2026.1733991

    Figure Lengend Snippet: TAMpep-IP inhibits polarization of M2 macrophages. (A) THP-1 monocytes were differentiated into M0 and M2 macrophages, and M2 cells were treated with TAMpep-IP (0.5 μM, 72 h). Quantitative RT-PCR analysis showed that TAMpep-IP significantly reduced the mRNA expression of TGF-β and Arg-1, two markers associated with M2 polarization. (B) ELISA was performed to measure the levels of secreted TGF-β and IL-13 in the culture supernatant of M0, M2, and TAMpep-IP–treated M2 macrophages (72 h). TAMpep-IP markedly decreased secretion of both cytokines. (C) Flow cytometric analysis was used to assess CD206 surface expression in M0, M2, and TAMpep-IP–treated M2 macrophages (72 h). CD206 expression was significantly decreased in the TAMpep-IP group compared to untreated M2 macrophages. All data are presented as mean ± SEM. *p<0.05, **p<0.01, ***p<0.001, ****p < 0.0001. (D) The expression of IL-1β mRNA was analyzed by quantitative RT-PCR in M0, M1, and M2 macrophages after TAMpep-IP. TAMpep-IP significantly upregulated IL-1β expression in M2 macrophages, to levels comparable with M1-polarized cells.

    Article Snippet: The human monocytic leukemia cell line THP-1 (KCLB; Korean Cell Line Bank, Seoul, Korea) was cultured in RPMI 1640 medium (Welgene, Gyeongsangbuk, Korea) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1% penicillin–streptomycin (Hyclone, Logan, UT, USA).

    Techniques: Quantitative RT-PCR, Expressing, Enzyme-linked Immunosorbent Assay

    B. lactis V9 Induces Immune Activation In Vitro . (a) Experimental workflow for evaluating cytokine responses in THP-1–derived macrophages. (b) Levels of cytokines TNF-α, IL-6, and IL-10 at different dose gradients. LPS; positive control; Control: blank control. * P < 0.05; ** P < 0.01, *** P < 0.0001; Kruskal–Wallis test.

    Journal: Frontiers in Immunology

    Article Title: Synergistic antitumor and immunomodulatory effects of Bifidobacterium animalis subsp. lactis V9 combined with anti–PD-1 therapy

    doi: 10.3389/fimmu.2026.1791276

    Figure Lengend Snippet: B. lactis V9 Induces Immune Activation In Vitro . (a) Experimental workflow for evaluating cytokine responses in THP-1–derived macrophages. (b) Levels of cytokines TNF-α, IL-6, and IL-10 at different dose gradients. LPS; positive control; Control: blank control. * P < 0.05; ** P < 0.01, *** P < 0.0001; Kruskal–Wallis test.

    Article Snippet: CT26 (murine colon carcinoma, BALB/c origin), MC38 (murine colon adenocarcinoma, C57BL/6 origin), 4T1 (murine mammary carcinoma, BALB/c origin), and THP-1 (human monocytic leukemia) cell lines were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA).

    Techniques: Activation Assay, In Vitro, Derivative Assay, Positive Control, Control